|
Li Jin, A Tale of 12,000 Y Chromosomes, Science, 11 May 2001.
Yuehai Ke, Bing Su, Xiufeng Song, Daru Lu, Lifeng Chen, Hongyu Li, Chunjian Qi, Sangkot Marzuki, Ranjan Deka, Peter Underhill, Chunjie Xiao, Mark Shriver, Jeff Lell, Douglas Wallace, R Spencer Wells, Mark Seielstad, Peter Oefner, Dingliang Zhu, Jianzhong Jin, Wei Huang, Ranajit Chakraborty, Zhu Chen, Li Jin, African Origin of Modern Humans in East Asia: A Tale of 12,000 Y Chromosomes, Science, 292:5519, pp. 1151-1153, Issue of 11 May 2001.
________________________________________________________________________
Yuehai Ke,1* Bing Su,2, 1, 3* Xiufeng Song,1 Daru Lu,1 Lifeng Chen,1 Hongyu Li,1 Chunjian Qi,1 Sangkot Marzuki,4 Ranjan Deka,5 Peter Underhill,6 Chunjie Xiao,7 Mark Shriver,8 Jeff Lell,9 Douglas Wallace,9 R Spencer Wells,10 Mark Seielstad,11 Peter Oefner,6 Dingliang Zhu,12 Jianzhong Jin,1 Wei Huang,12, 13 Ranajit Chakraborty,3 Zhu Chen,12, 13 Li Jin1, 3, 13
To test the hypotheses of modern human origin in East Asia, we sampled 12,127 male individuals from 163 populations and typed for three Y chromosome biallelic markers (YAP, M89, and M130). All the individuals carried a mutation at one of the three sites. These three mutations (YAP+, M89T, and M130T) coalesce to another mutation (M168T), which originated in Africa about 35,000 to 89,000 years ago. Therefore, the data do not support even a minimal in situ hominid contribution in the origin of anatomically modern humans in East Asia.
1 State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, 220 Handan Road, Shanghai, China 200443, and Morgan-Tan International Center for Life Sciences, Shanghai, China.
2 Kunming Institute of Zoology, the Chinese Academy of Sciences, Kunming, China.
3 Human Genetics Center, University of Texas-Houston, 1200 Herman Pressler E547, Houston, TX 77030, USA.
4 Eijkman Institute for Molecular Biology, Jakarta, Indonesia.
5 Department of Environmental Health, University of Cincinnati, Cincinnati, OH 45267, USA.
6 Department of Genetics, Stanford University, Stanford, CA 94305, USA.
7 Department of Biology, Yunnan University, Kunming, China.
8 Department of Anthropology, Pennsylvania State University, University Park, PA 16802, USA.
9 Center for Molecular Medicine, Emory University School of Medicine, Atlanta, GA 30322, USA.
10 Wellcome Trust Center for Human Genetics, University of Oxford, UK.
11 Program for Population Genetics, Harvard School of Public Health, Boston, MA 02115, USA.
12 Shanghai Second Medical University, Shanghai, China.
13 National Human Genome Center at Shanghai, China.
* These authors contributed equally to this work.
To whom correspondence should be addressed. E-mail: ljin@fudan.edu or ljin@sph.uth.tmc.edu
________________________________________________________________
The "Out-of-Africa" hypothesis suggests that anatomically modern humans originated in Africa about 100,000 years ago and then spread outward and completely replaced local archaic populations outside Africa (1, 2). This proposition has been supported by genetic evidence and archaeological findings (3-9). The replacement in Europe was supported by recent ancient DNA analyses, which ruled out the contribution of Neanderthals to modern Europeans (10, 11). However, it has been argued that the abundant hominid fossils found in China and other regions in East Asia (e.g., Peking man and Java man) demonstrate continuity, not only in morphological characters but also in spatial and temporal distributions (12-16). In this report, we test the competing hypotheses of modern Asian human origins using Y chromosome polymorphisms.
We sampled 12,127 male individuals from 163 populations across Southeast Asia, Oceania, East Asia, Siberia, and Central Asia and typed for three Y chromosome biallelic markers (YAP, M89, and M130) (17, 18) (Table 1). Being a single-locus multiple-site (i.e., haplotype) system, the Y chromosome is one of the most powerful molecular tools for tracing human evolutionary history (5, 9, 19-21). In previous Y chromosome studies, an extreme geographic structure was revealed in global populations in which the oldest clade represents Africans and the younger ones represent some Africans and all non-African populations (21).
One Y chromosome polymorphism (C to T mutation) at the M168 locus is shared by all non-African populations and was originally derived from Africa on the basis of a study of 1062 globally representative male individuals (21). The age of M168 was estimated at 44,000 years (95% confidence interval: 35,000 to 89,000 years), marking the recent Out-of-Africa migrations (21). Under the M168T lineage, there are three major derived sublineages defined by polymorphisms at loci YAP (Alu insertion) (5), M89 (C to T mutation), and M130 (C to T mutation, also called RPS4Y) (Fig. 1) (21, 22). Therefore, these three markers can be used to test the completeness of the replacement of modern humans of African origin in East Asia. An observation of a male individual not carrying one of the three polymorphisms would be indicative of a potential ancient origin and could possibly lead to the rejection of such completeness.
Each of the 12,127 samples typed carried one of the three polymorphisms (YAP+, M89T, or M130T) (Table 1). In other words, they all fall into the lineage of M168T that was originally derived from Africa. Hence, no ancient non-African Y chromosome was found in the extant East Asian populations (P = 5.4 × 106 assuming a frequency of 1/1000 of local contribution in the extant populations), suggesting an absence of either an independent origin or a 1,000,000-year shared global evolution. This result indicates that modern humans of African origin completely replaced earlier populations in East Asia.
It was argued that the extensive genetic data supporting the Out-of-Africa hypothesis could also be explained by the multiregional hypothesis under a version of the trellis model (23). This model suggests that a multiregional evolutionary paradigm is shared across the human range by frequent gene exchanges between continental populations since Homo erectus came out of Africa about 1 million years ago (23). It is difficult to test the trellis model with markers from mitochondrial hypervariable region (D-loop) and autosome because these markers show frequent recurrent mutations and/or recombination (24, 25), respectively. However, this can be circumvented by the application of a large number of Y chromosome biallelic markers, which escape recombination and have a low mutation rate.
It has been shown that all the Y chromosome haplotypes found outside Africa are younger than 35,000 to 89,000 years and derived from Africa (21), although this estimation is crude and depends on several assumptions. In addition, if extensive gene flow had occurred between continental populations during the past 1 million years but before the divergence between Africans and non-Africans, as suggested by the multiregionalists, the ancient Y chromosome haplotypes seen in African populations or even much older haplotypes would have been expected in East Asia, which was not observed in our data.
However, this observation does not necessarily preclude the possibility of selection sweep that could erase archaic Y chromosomes of modern humans in East Asia. On the other hand, a minor contribution from a female lineage of local origin cannot be excluded either, which should be further studied with the use of mitochondrial DNA (mtDNA) markers. Because the Y chromosome has a relatively small effective population size, it is subject to stochastic process, e.g., genetic drift, which could also lead to extinction of archaic lineages. However, in our study, with 163 populations from different regions of Asia, it is hard to imagine that all of the 163 populations should drift in the same direction.
Inconsistency of age estimations for a common ancestor with the use of mitochondrial/Y chromosome and autosome/X chromosome markers, however, creates confusion. The age estimated with the use of autosome/X chromosome genes ranges from 535,000 to 1,860,000 years (26-29), much older than those for mtDNA and Y chromosome. However, this difference in age estimation might only reflect the difference in the effective population sizes between Y chromosome/mtDNA and X chromosome/autosome (three to four times as many as the former) in the presence of bottleneck events associated with the outbound migrations from Africa, therefore disqualifying the utility of the latter in distinguishing the competing hypotheses (24, 30).
REFERENCES AND NOTES
1. R. L. Cann, M. Stoneking, A. C. Wilson, Nature 325, 31 (1987) [Medline].
2. L. Vigilant, M. Stoneking, H. Harpending, K. Hawkes, A. C. Wilson, Science 253, 1503 (1991) [Medline].
3. C. B. Stringer and P. Andrew, Science 239, 1263 (1988) [Medline].
4. A. M. Bowcock, et al., Nature 368, 455 (1994) [Medline].
5. M. F. Hammer, Nature 378, 376 (1995) [Medline].
6. S. A. Tishkoff, et al., Science 271, 1380 (1996) .
7. J. Y. Chu, et al., Proc. Natl. Acad. Sci. U.S.A. 95, 11763 (1998) [Abstract/Full Text].
8. L. Quintana-Murci, et al., Nature Genet. 23, 437 (1999) [Medline].
9. B. Su, et al., Am. J. Hum. Genet. 65, 1718 (1999) [Medline].
10. M. Krings, et al., Cell 90, 19 (1997) [Medline].
11. V. O. Igor, et al., Nature 404, 490 (2000) [Medline].
12. A. S. Brooks and B. Wood, Nature 344, 288 (1990) [Medline].
13. T. Li and D. A. Etler, Nature 357, 404 (1992) [Medline].
14. X. Z. Wu, F. E. Poirier, Human Evolution in China (Oxford Univ. Press, Oxford, 1995).
15. D. A. Etler, Annu. Rev. Anthropol. 25, 275 (1996) .
16. C. C. Swisher, et al., Science 274, 1870 (1996) [Abstract/Full Text].
17. A total of 163 populations were sampled from Central Asia (Crimean Tatar, Iranian, Dungan, Tajik, Turkmen, Karakalpak, Eastern Uzbek, Sinte Romani, Khorezmian Uzbek, Uighur, Kazak, Bukharan Arab, and Kyrgyz); Central Siberia (Tuvan, Tofalar, Yenisey Evenk, Buryat-1, and Buryat-2); Okhotsk/Amur (Okhotsk Evenk, Ulchi/Nanai, Upriver Negidal, Downriver Negidal, Udegey, and Nivkh); Kamchatka/Chukotka (Koryak, Itelman, Chukchi, and Siberian Eskimo); northern East Asia (Ewenki, Manchurian-1, Manchurian-2, Korean, Japanese, Hui-1, Hui-2, Jingpo, Tu, Sala, Mongolian-1, Mongolian-2, Tibetan-Qinghai, Tibetan-Tibet, Tibetan-Yunnan, Kazak-Xinjiang, and Uyghur); northern Han Chinese (Heilongjiang, Liaoning, Hebei, Beijing, Tianjin, Shandong, Shanxi, Gansu, Xinjiang, Henan, Inner-Mongolia, Qinghai, Shaanxi, and Jilin); southern Han Chinese (Anhui, Zhejiang, Jiangsu, Shanghai, Hubei, Sichuan, Jiangxi, Hunan, Fujian, Yunnan, Guangxi, Guangdong, and Guizhou); Taiwan (Bunun, Atayal, Yami, Paiwan, and Ami); Southeast Asia (Tujia, Yao-Nandan, Yao-Jinxiu, Zhuang, Dong, Wa-1, Wa-2, Wa-3, Aini, Blang-1, Blang-2, Lahu-1, Lahu-2, Lahu-3, Lahu-4, Deang, Yi, She, Li, Cambodian, Dai-1, Dai-2, Akha, Karen, Lisu, Jino, Hmong, Yao, Kinh, Muong, Naxi, Ahom, So, Northern Thailand, Northeast Thailand, Bai-1, and Bai-2); Indonesia/Malaysia [Malay CB, Malay KM, Orang Asli, Batak, Malay (Pakanbaru), Minangkabau, Palembang, Bangka, Nias, Dayak, Java, Tengger, Bali, Sasak, Sumbawa, Sumba, Alor, Makassar, Bugis, Torajan, Kaili, Manado, Irian, Kota Kinabalu, and Sakai]; Polynesia/Micronesia (Truk, Guam, Palau, Majuro, Kribati, Pohnpei, Nauru, Kapingamarangi, Tonga, American Somoan, and West Somoan); Papuan and New Guinean Highland (Australian Aborigine, Nasioi-Melanesian, New Guinean-1, New Guinean-2, Bankes and Torres, Santo, and Maewo); and Northeastern India [Adi, Nishi, Assam, Apatani, Rabha(Assam), and Naga]. The numbered populations of the same ethnicity were sampled independently.
18. Genotyping was conducted by a polymerase chain reaction restriction fragment length polymorphism assay. The restriction sites were engineered for M130 (Bsl I) and M89 (Nla III) by designing mismatch primers. The primer sequences are ACAGAAGGATGCTGCTCAGCTT/GCAACTCAGGCAAAGTGAGACAT (M89) and TATCTCCTCTTCTATTGCAG/CCACAAGGGGGAAAAAACAC (M130). The typing of YAP follows previous reports (5, 9). Genotyping was repeated to clarify any equivocal typing results.
19. M. A. Jobling, et al., Trends Genet. 11, 449 (1995) [Medline].
20. P. A. Underhill, et al., Ann. Hum. Genet. 65, 43 (2001) .
21. P. A. Underhill, et al., Nature Genet. 26, 358 (2000) [Medline].
22. A. W. Bergen, et al., Ann. Hum. Genet. 63, 63 (1999) [Medline].
23. M. H. Wolpoff, J. Hawks, R. Caspari, Am. J. Phys. Anthropol. 112, 129 (2000) [Medline].
24. L. Jin and B. Su, Nature Rev. Genet. 1, 126 (2000) .
25. M. Stoneking, et al., Curr. Opin. Genet. Dev. 6, 731 (1996) [Medline].
26. R. M. Harding, et al., Am. J. Hum. Genet. 60, 772 (1997) [Medline].
27. H. Kaessmann, F. Heissig, A. Haeseler, S. Paabo, Nature Genet. 22, 78 (1999) [Medline].
28. E. Harris and J. Hey, Proc. Natl. Acad. Sci. U.S.A. 96, 3320 (1999) [Abstract/Full Text].
29. Z. M. Zhao, et al., Proc. Natl. Acad. Sci. U.S.A. 97, 11354 (2000) [Abstract/Full Text].
30. J. C. Fay and C. I. Wu, Mol. Biol. Evol. 16, 1003 (1999) [Medline].
31. We thank all the 12,127 men who donated DNA for this study. This study was supported by the China Natural Science Foundation. B.S., R.C., and L.J. were supported by NIH grants. R.D. was supported by the Center for Environmental Genetics at the University of Cincinnati.
20 February 2001; accepted 20 March 2001
10.1126/science.1060011
Include this information when citing this paper.
Related articles in Science:
HUMAN ANTHROPOLOGY:
Modern Men Trace Ancestry to African Migrants.
Ann Gibbons
Science 2001 292: 1051-1052. (in News Focus) [Summary] [Full Text]
|